rs6469038 chr8:106081348 G>A
- Sequence
tacctactttgcaggcatgttatg[G/A]aattaaatgagataatgtatacca
- ASB in cell types
- MS-1 (Small cell lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MS-1 (Small cell lung carcinoma) | 1.12 | n/a | 1.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP age at death with kuru exposure, birth weight, hypertension (early onset hypertension), pulse pressure, stabilized warfarin dose, total cholesterol change with statins