rs6469646 chr8:116471862 A>C
- Sequence
agcaaaggtagcagcttagacata[A/C]aagtgcaaacactggagggggaaa
- ASB in cell types
- macrophages MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- NFIB_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NFIB_HUMAN | n/a | 2.04 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP fasting blood glucose, fasting insulin, hdl cholesterol, height, homa-ir, refractive error, triglycerides, urinary albumin-to-creatinine ratio