rs6469684 chr8:117235970 T>A
- Sequence
tttgcaaagtaggcattttaactg[T/A]cgtttgttaagacaactttcttta
- ASB in cell types
- 2588 (Lymphoblastoid Cell Lines) foreskin keratinocyte IPSC-derived bipolar neuron
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 2588 (Lymphoblastoid Cell Lines) | -3.43 | 1.95 | 1.50 | |||
| foreskin keratinocyte | 1.09 | -3.09 | 2.17 | |||
| IPSC-derived bipolar neuron | -0.78 | 1.39 | 1.00 |
Items per page:
1 – 3 of 3