rs6469828 chr8:119495790 T>A
- Sequence
ccataaaaccccaaaatcattgac[T/A]cttacacttccacatttctgcctt
- ASB in cell types
- THP-1 (acute monocytic leukemia)
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 0.29 | 1.72 | 2.10 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP diastolic blood pressure (dbp), fasting blood glucose, hdl cholesterol, height, infant head circumference, ldl cholesterol, ldl cholesterol change with statins, total cholesterol, total cholesterol change with statins
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Lung, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg