rs6470541 chr8:127586055 G>A
- Sequence
tcaaggccactctattccactgtg[G/A]gccagttgagattattagagaatt
- ASB in cell types
- CFPAC-1(pancreatic ductal adenocarcinoma)
- ASB for transcription factors
- FOXA2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXA2_HUMAN | -0.28 | 2.72 | 3.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP comorbid depressive syndrome and alcohol dependence, fasting insulin, homa-ir, systolic blood pressure (sbp)