rs6470588 chr8:127877125 A>C
- Sequence
gaaagtttcctctcgccgaggagg[A/C]caactccccagcgcctgagacagc
- ASB in cell types
- BEAS-2B (bronchial epithelium) HKC8 (kidney proximal tubule cell line)
- ASB for transcription factors
- EPAS1_HUMAN GCR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| EPAS1_HUMAN | 1.43 | -1.23 | 6.00 | n/a | No Hit | |||
| GCR_HUMAN | 1.34 | -0.12 | 2.04 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP comorbid depressive syndrome and alcohol dependence, hdl cholesterol change with statins, obesity with early age of onset (age >2), plasma renin activity, total cholesterol