rs6472935 chr8:75726341 A>G
- Sequence
ctagggaatgtgaaagctatatct[A/G]cttatcaacttggacagtaggggt
- ASB in cell types
- FT282 (normal human fallopian tube tissue) GM18951 (B-cells Lymphoblastoid Cell Lines) OVCAR8 (high grade ovarian serous adenocarcinoma) HeLa (cervical adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| FT282 (normal human fallopian tube tissue) | 1.79 | -0.66 | 1.00 | |||
| GM18951 (B-cells Lymphoblastoid Cell Lines) | 1.22 | -1.22 | 1.00 | |||
| OVCAR8 (high grade ovarian serous adenocarcinoma) | -4.70 | 2.60 | 2.00 | |||
| HeLa (cervical adenocarcinoma) | -3.46 | 2.05 | 2.50 | |||
| MCF10AT1 (breast premetastatic epithelial cells) | 2.24 | -2.06 | 1.00 |
Items per page:
1 – 5 of 5