rs6474722 chr9:12655080 A>G
- Sequence
aaatacatttcctggtattcaaca[A/G]ttgtctgccatttaacaatcaact
- ASB in cell types
- MOLM14 (Adult acute myeloid leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MOLM14 (Adult acute myeloid leukemia) | 0.27 | 1.84 | 3.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Caudate_basal_ganglia, Brain_Putamen_basal_ganglia, Muscle_Skeletal, Skin_Sun_Exposed_Lower_leg