rs6475119 chr9:1732828 T>G
- Sequence
tgaagcttctaatattcagtaatg[T/G]ggaaacctgcacactgttgcccat
- ASB in cell types
- GM18526 (B – cells Lymphoblastoid Cell Lines) GM17942 (lymphoblastoid cell) HUES64 (embryonic stem cells) GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- STAG1_HUMAN RAD21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 0.56 | 2.13 | 2.26 | n/a | n/a | |||
| RAD21_HUMAN | -0.30 | 2.49 | 1.50 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP college completion, obesity with early age of onset (age >2), waist hip ratio, years of education