rs6477178 chr9:7234343 C>T
- Sequence
ctgaaactgattaacttggttttt[C/T]tggtgactagccccatcctgaggc
- ASB in cell types
- erythroid progenitors TTC-1240 (Rhabdoid tumor of the kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| erythroid progenitors | 3.21 | n/a | 2.00 | |||
| TTC-1240 (Rhabdoid tumor of the kidney) | -3.39 | 2.19 | 1.33 |
Items per page:
1 – 2 of 2