rs6477714 chr9:109605120 G>T
- Sequence
caaattcttcacagcctagagcag[G/T]atttctcaaccttttatctattat
- ASB in cell types
- A-673 clone Asp114 (Ewing sarcoma)
- ASB for transcription factors
- FLI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FLI1_HUMAN | 1.68 | -1.12 | 1.33 | n/a | No Hit |
Items per page:
1 – 1 of 1