rs6478010 chr9:113383232 G>A
- Sequence
aggtgtggaatcacagggtcataa[G/A]gtatgcatatgttcagctttggta
- ASB in cell types
- HepG2 (hepatoblastoma) breast tumor
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 0.89 | -0.03 | 1.19 | |||
| breast tumor | 1.92 | -0.49 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Whole_Blood