rs6479554 chr9:94563716 A>G
- Sequence
gacaatatcctgcagcaatcttaa[A/G]agagccgctaaacaaacaaagaaa
- ASB in cell types
- HepG2 (hepatoblastoma) GM12891 (male B- cells lymphoblastoid cell line) GM19099 (female B-cells Lymphoblastoid Cell Lines)
- ASB for transcription factors
- FOXA2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXA2_HUMAN | 3.57 | n/a | 1.33 | n/a | No Hit |
Items per page:
1 – 1 of 1