rs6479733 chr10:60816888 T>A
- Sequence
aggcagccaggctaataaaaaaaa[T/A]ttttttttaaaccaacactatgaa
- ASB in cell types
- Peyer's patch
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| Peyer's patch | -1.00 | 1.78 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, advanced age-related macular degeneration (geographic atrophy), obesity with early age of onset (age >2), rheumatoid arthritis, total cholesterol