rs6480616 chr10:72298086 C>T
- Sequence
agggactgggagagatgcgtcacc[C/T]gctaatccctcaactgggtcgcac
- ASB in cell types
- HUES64 (embryonic stem cells) tibial nerve MDA-MB-231-1833 (breast cancer cells, bone-tropic metastatic line) LN95(Prostate adenocarcinoma)
- ASB for transcription factors
- OTX2_HUMAN CDN1B_HUMAN JUN_HUMAN SRBP1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| OTX2_HUMAN | 3.52 | -1.43 | 1.42 | n/a | No Hit | |||
| CDN1B_HUMAN | 0.30 | 1.25 | 2.00 | n/a | n/a | |||
| JUN_HUMAN | 0.46 | 1.18 | 1.96 | n/a | No Hit | |||
| SRBP1_HUMAN | -1.59 | 2.23 | 1.50 | -0.13 | Weak Discordant |
Items per page:
1 – 4 of 4
Motif analysis
Genetic associations
GRASP college completion, microalbuminuria, total cholesterol, triglycerides, waist hip ratio, years of education
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Ovary, Pancreas, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Thyroid, Whole_Blood