rs6480721 chr10:74157103 G>A
- Sequence
aagctgtggacctggagtgaagat[G/A]cagaagtggctgagctgccagatg
- ASB in cell types
- K562 (myelogenous leukemia) CD34+ hematopoietic stem cells-derived proerythroblasts
- ASB for transcription factors
- HTF4_HUMAN GATA1_HUMAN MTG16_HUMAN HDAC1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| HTF4_HUMAN | -0.92 | 2.45 | 1.33 | n/a | No Hit | |||
| GATA1_HUMAN | -0.40 | 2.20 | 3.17 | n/a | No Hit | |||
| MTG16_HUMAN | -2.84 | 1.80 | 1.50 | n/a | n/a | |||
| HDAC1_HUMAN | -1.61 | 1.85 | 1.00 | n/a | n/a | |||
| MTG8R_HUMAN | -3.88 | 2.12 | 1.50 | n/a | n/a |
Items per page:
1 – 5 of 5
Motif analysis
No data available
Genetic associations
GRASP arthritis including non-rheumatoid, bipolar disorder, diastolic blood pressure (dbp), irritible bowel syndrome, longstanding arthritis, partial epilepsy, rheumatoid arthritis, tetrology of fallot
GTEx eQTL Artery_Coronary, Artery_Tibial, Brain_Amygdala, Brain_Cerebellar_Hemisphere, Colon_Sigmoid, Colon_Transverse, Esophagus_Mucosa, Lung, Muscle_Skeletal, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood