rs6481819 chr10:33010531 T>C
- Sequence
gtggttttggagctcacaggcaca[T/C]gaggaataattaaaaaccactgcc
- ASB in cell types
- A549 (lung carcinoma) RMG-1 adrenal gland 22RV1 (prostate carcinoma)
- ASB for transcription factors
- GCR_HUMAN ARI1A_HUMAN JUN_HUMAN EP300_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GCR_HUMAN | 2.17 | 1.22 | 1.50 | n/a | No Hit | |||
| ARI1A_HUMAN | 1.73 | -1.43 | 1.00 | n/a | n/a | |||
| JUN_HUMAN | 1.34 | 0.18 | 1.92 | n/a | No Hit | |||
| EP300_HUMAN | 1.23 | 0.41 | 2.00 | n/a | n/a | |||
| STAG1_HUMAN | 1.55 | -1.06 | 1.00 | n/a | n/a |
Items per page:
1 – 5 of 5
Motif analysis
No data available
Genetic associations
GRASP depression scale of the revised neo personality inventory, diastolic blood pressure (dbp), partial epilepsy, waist hip ratio
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood