rs6481837 chr10:33156436 C>T
- Sequence
catggagatgatgatgagtgataa[C/T]gccagactcattagcatgaagcat
- ASB in cell types
- MS-1 (Small cell lung carcinoma) CD34+ hematopoietic stem cells-derived proerythroblasts
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MS-1 (Small cell lung carcinoma) | -2.06 | 2.33 | 1.00 | |||
| CD34+ hematopoietic stem cells-derived proerythroblasts | 1.54 | -0.87 | 2.00 |
Items per page:
1 – 2 of 2