rs6483435 chr11:95524438 C>A
- Sequence
cagagtgaaaactttttaatctcc[C/A]cccgcccccactatcaacatcgct
- ASB in cell types
- HEK293 (embryonic kidney)
- ASB for transcription factors
- PATZ1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PATZ1_HUMAN | -1.91 | 2.40 | 1.00 | -3.92 | Discordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP college completion, homa-b, hypertension (early onset hypertension), spine bone mineral density (bmd), urinary albumin-to-creatinine ratio, years of education