rs6483624 chr11:19951708 T>C
- Sequence
acactctaacctgaatcttagtga[T/C]agccgactgagaaactcctggttt
- ASB in cell types
- WA01 (H1, human embryonic stem cells)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| WA01 (H1, human embryonic stem cells) | 1.72 | -0.42 | 1.17 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, advanced age-related macular degeneration, fasting blood glucose, fasting insulin, homa-ir, ldl cholesterol