rs6485690 chr11:46777081 A>G
- Sequence
ttattcactatagcaaaatgttac[A/G]caattacgttataatcataatagc
- ASB in cell types
- MSC (mesenchymal stem cells)
- ASB for transcription factors
- CEBPB_HUMAN CEBPG_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CEBPB_HUMAN | -2.88 | 2.75 | 1.50 | 5.14 | Concordant | |||
| CEBPG_HUMAN | n/a | 3.05 | 2.00 | 4.24 | Concordant |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP aortic valve calcium, c11orf49 gene expression in adipose tissue (female), carotid-femoral pulse wave velocity, fasting blood glucose, femoral neck bone mineral density (bmd), hdl cholesterol, hip bone mineral density (bmd), ldl cholesterol, total cholesterol, total hip bone mineral density (bmd) (postmenopausal females), triglycerides
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellum, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Ovary, Pancreas, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Thyroid, Whole_Blood