rs6486101 chr11:13183287 G>A
- Sequence
ttgaatgtccattcattctttcgt[G/A]gtggaatggaattcacactcagcc
- ASB in cell types
- pancreas
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| pancreas | 2.06 | n/a | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi), fasting blood glucose, hdl cholesterol change with statins, triglycerides