rs6486337 chr11:17013097 C>G
- Sequence
tttaccgagtgcctacttgctgtc[C/G]ggcactggggcaaggggtcaaagg
- ASB in cell types
- HT29 (colon adenocarcinoma) BJ (fibroblasts)
- ASB for transcription factors
- PPARG_HUMAN P63_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PPARG_HUMAN | 0.91 | 3.11 | 2.88 | n/a | No Hit | |||
| P63_HUMAN | 1.82 | 0.04 | 1.50 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Colon_Transverse, Esophagus_Mucosa, Lung, Minor_Salivary_Gland, Nerve_Tibial, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Stomach, Thyroid, Whole_Blood