rs6486433 chr11:9573143 T>G
- Sequence
catttccggctcagacctcgaccc[T/G]gaacgtggctgcccactgccacgc
- ASB in cell types
- breast tumor TTC-1240 (Rhabdoid tumor of the kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| breast tumor | 0.66 | 2.94 | 2.00 | |||
| TTC-1240 (Rhabdoid tumor of the kidney) | 0.02 | 1.02 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Caudate_basal_ganglia, Cells_EBV-transformed_lymphocytes, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Thyroid