rs6486683 chr12:131454973 C>T
- Sequence
tcacatgcccacagcaactatcgc[C/T]taaggaagagacgtctcccgacca
- ASB in cell types
- adrenal gland GM18951 (B-cells Lymphoblastoid Cell Lines) HCT-116-RAD21-mAC ovary
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| adrenal gland | 1.86 | 0.02 | 1.00 | |||
| GM18951 (B-cells Lymphoblastoid Cell Lines) | 1.12 | -1.05 | 1.00 | |||
| HCT-116-RAD21-mAC | 0.14 | 1.63 | 1.00 | |||
| ovary | n/a | 2.49 | 1.00 | |||
| tibial nerve | 1.61 | -1.40 | 1.00 |
Items per page:
1 – 5 of 6