rs6487223 chr12:21437463 T>C
- Sequence
cttttttatttttaattttttggt[T/C]ttctctttgtcaaattttcatgga
- ASB in cell types
- HEK293 (embryonic kidney) GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.11 | 0.80 | 2.02 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.94 | 0.75 | 1.04 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP hdl cholesterol, height, obesity with early age of onset (age >2), total cholesterol, triglycerides