rs6487366 chr12:23950416 G>C
- Sequence
ctctgtcggtctcactgttagctc[G/C]tgctttccgcaaagtggtgcgaac
- ASB in cell types
- HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.73 | 0.05 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP biologic age by osseographic scoring system, walking speed at advanced age, cystatin c in serum, height, ldl cholesterol, total cholesterol, triglycerides