rs6488668 chr12:7806995 C>T
- Sequence
ttttgaaacacagattagactgtc[C/T]ctctttgggcaaagccattaagtc
- ASB in cell types
- CD34+ stem cells-derived erythroblasts heart left ventricle
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CD34+ stem cells-derived erythroblasts | n/a | 3.44 | 2.00 | |||
| heart left ventricle | -1.60 | 1.90 | 1.00 |
Items per page:
1 – 2 of 2