rs6490474 chr13:30648583 T>C
- Sequence
tttgtcatcaacatatgcactccg[T/C]agtactcatgtcttcactttgccc
- ASB in cell types
- LNCaP (prostate carcinoma)
- ASB for transcription factors
- FOXA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXA1_HUMAN | 1.20 | 0.03 | 1.76 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), hdl cholesterol, irritible bowel syndrome, paternal transmission distortion, primary rhegmatogenous retinal detachment, sporadic creutzfeldt-jakob disease, transmission distortion, triglycerides, years of education