rs6492278 chr13:110456033 T>C
- Sequence
gcccccagcagcagcttgtgtgtc[T/C]tgcagacacacaccctcctcctgc
- ASB in cell types
- neutrophils from periferal blood D54 (H54, Human glioblastoma) VCaP (prostate carcinoma) foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neutrophils from periferal blood | 2.42 | 0.23 | 1.50 | |||
| D54 (H54, Human glioblastoma) | 3.17 | n/a | 2.00 | |||
| VCaP (prostate carcinoma) | 2.61 | n/a | 3.00 | |||
| foreskin keratinocyte | n/a | 0.37 | 2.83 |
Items per page:
1 – 4 of 4