rs6493299 chr15:47841489 G>A
- Sequence
atacatagctaatccctttttaaa[G/A]aaactggaagaaaaacaaaaacat
- ASB in cell types
- LNCaP (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LNCaP (prostate carcinoma) | 0.95 | -0.17 | 1.52 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), bipolar disorder, fasting insulin, height, homa-b, homa-ir, salmonella-induced pyroptosis