rs6493893 chr15:56821683 A>C
- Sequence
caagaaaagcctccatcccttttg[A/C]gcatgtcaattattacaacagact
- ASB in cell types
- GM19099 (female B-cells Lymphoblastoid Cell Lines) GM12890 (Lymphoblastoid Cell Lines) spleen
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19099 (female B-cells Lymphoblastoid Cell Lines) | -0.10 | 2.19 | 1.00 | |||
| GM12890 (Lymphoblastoid Cell Lines) | -1.20 | 1.39 | 1.00 | |||
| spleen | -1.86 | 2.40 | 1.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP bipolar disorder, cystatin c in serum, fasting insulin, homa-ir, ldl cholesterol, neuroticism, simpson-angus scale, total cholesterol, triglycerides, waist hip ratio
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Nerve_Tibial, Ovary, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid