rs6494206 chr15:60520080 C>T
- Sequence
ggggaaagcaggcacgcaagcaga[C/T]acaccttattctctacagcatcat
- ASB in cell types
- CFPAC-1(pancreatic ductal adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CFPAC-1(pancreatic ductal adenocarcinoma) | 0.22 | 1.16 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Esophagus_Mucosa, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg