rs6494940 chr15:71512779 A>G
- Sequence
gaaataaaaagtatccagtatccc[A/G]gcaggacagagcaactgcgtaagt
- ASB in cell types
- breast tumor
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| breast tumor | 2.19 | n/a | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), hip bone mineral density (bmd), hypertension (early onset hypertension), ldl cholesterol, mitral annular calcium, statin induced myopathy, triglycerides