rs6494955 chr15:29344664 A>G
- Sequence
cacaccagaggtggagtggggagg[A/G]gtgtcctctggtggaaggtcagtg
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) GM19239 (male B-cells lymphoblastoid cell line) GM02255 (Lymphoblastoid Cell Lines) MS-1 (Small cell lung carcinoma)
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.97 | 0.09 | 1.17 | 0.20 | Weak Discordant | |||
| STAG1_HUMAN | 2.03 | -0.33 | 1.05 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
