rs6495498 chr15:80419287 C>G
- Sequence
gatgctggtactgctggcccagat[C/G]cccttcaggtccactgaggcaggg
- ASB in cell types
- foreskin keratinocyte pancreas
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | -1.14 | 2.71 | 2.67 | |||
| pancreas | 2.11 | -1.61 | 1.00 |
Items per page:
1 – 2 of 2