rs6496264 chr15:97898996 A>G
- Sequence
gtaactcagtgtgcagcttgctct[A/G]tgtcaataaaatatgtcgctttcc
- ASB in cell types
- GM12890 (Lymphoblastoid Cell Lines) GM19240 (B cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12890 (Lymphoblastoid Cell Lines) | 3.36 | -3.05 | 1.00 | |||
| GM19240 (B cells Lymphoblastoid Cell Lines) | 2.17 | -1.74 | 1.00 |
Items per page:
1 – 2 of 2