rs6496265 chr15:97899241 C>G
- Sequence
aagaggttttctgtttcaggctgg[C/G]acgtacacaggctgcttaagagaa
- ASB in cell types
- GM12890 (Lymphoblastoid Cell Lines) esophagus muscularis mucosa
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12890 (Lymphoblastoid Cell Lines) | 4.00 | -3.67 | 1.00 | |||
| esophagus muscularis mucosa | 2.37 | 0.02 | 1.00 |
Items per page:
1 – 2 of 2