rs6496635 chr15:90158464 G>A
- Sequence
ccagctgctcccagccctgccagc[G/A]ctgggattgtgtggtgtgatcaag
- ASB in cell types
- K562 (myelogenous leukemia) HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.06 | 0.81 | 2.00 | |||
| HEK293 (embryonic kidney) | 0.07 | 0.75 | 1.87 |
Items per page:
1 – 2 of 2