rs6496698 chr15:90592326 A>G
- Sequence
tgctatgtatacatatatcaaaac[A/G]tcatgttgtacagtgtaaatatat
- ASB in cell types
- JB6 (Human anaplastic large cell lymphoma) HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| JB6 (Human anaplastic large cell lymphoma) | 1.80 | n/a | 3.00 | |||
| HEK293 (embryonic kidney) | 0.75 | -0.08 | 1.89 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Brain_Cerebellum, Colon_Transverse, Esophagus_Muscularis, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid