rs6497117 chr15:85413397 C>T
- Sequence
tcaggatggctgtagttcagttgt[C/T]gttgcttatgctagttctttcatt
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) GM18486 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | -3.68 | 1.96 | 1.50 | |||
| GM18486 (Lymphoblastoid Cell Lines) | 1.30 | -0.90 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP chronic kidney disease, coronary artery disease (cad), combined control dataset, gender differentiated, cystatin c in serum, hdl cholesterol, height, ldl cholesterol, neuroticism, serum creatinine, total cholesterol, variant creutzfeldt-jakob disease
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Brain_Cortex, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Ovary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid