rs6497171 chr15:94120202 A>C
- Sequence
aacttgactatggaaatagccacc[A/C]aacggttcacaagtgacactaaca
- ASB in cell types
- RWPE2 H929 (plasma cell myeloma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| RWPE2 | 0.97 | -0.97 | 1.00 | |||
| H929 (plasma cell myeloma) | -1.18 | 1.18 | 1.00 |
Items per page:
1 – 2 of 2