rs6497172 chr15:94120209 T>C
- Sequence
ctatggaaatagccaccaaacggt[T/C]cacaagtgacactaacagtggcta
- ASB in cell types
- RWPE2 erythroid cells
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| RWPE2 | 0.99 | -0.99 | 1.00 | |||
| erythroid cells | 2.71 | -1.91 | 2.00 |
Items per page:
1 – 2 of 2