rs6497845 chr16:10256791 C>G
- Sequence
gaaaaaaaaaaaagaatggagaaa[C/G]tcacaggcagagagggcagctcct
- ASB in cell types
- transverse colon spleen
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| transverse colon | 2.63 | -2.67 | 1.00 | |||
| spleen | 2.24 | -2.06 | 1.00 |
Items per page:
1 – 2 of 2