rs6498139 chr16:10954066 G>A
- Sequence
ataaacatatatgaacaggcaccc[G/A]gtttcactactggaagaaagcccc
- ASB in cell types
- CD34+ hematopoietic stem cells CD34+ stem cells-derived erythroblasts T47D (invasive ductal carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CD34+ hematopoietic stem cells | 2.46 | n/a | 2.00 | |||
| CD34+ stem cells-derived erythroblasts | 2.29 | -4.75 | 2.00 | |||
| T47D (invasive ductal carcinoma) | 0.36 | 0.87 | 2.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP ldl cholesterol, multiple sclerosis severity scale (continuous), multiple sclerosis severity scale (extreme), multiple sclerosis severity scale (median), total cholesterol change with statins
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Cells_Cultured_fibroblasts, Lung, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid