rs6499991 chr16:58937796 A>G
- Sequence
ggttctgcaggcttaacaggaagc[A/G]tggctaggaggcctcagggaactt
- ASB in cell types
- SEM (childhood B acute lymphoblastic leukemia)
- ASB for transcription factors
- FLI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FLI1_HUMAN | -3.76 | 2.37 | 1.33 | -0.03 | Weak Discordant |
Items per page:
1 – 1 of 1
Motif analysis
