rs6500493 chr16:88737574 C>G
- Sequence
ggtactcaccaggccgccgcagga[C/G]ggagctctggccggtcagctcgtg
- ASB in cell types
- HEK293 (embryonic kidney) HCT-116 (colon carcinoma) GM19240 (B cells Lymphoblastoid Cell Lines) MS-1 (Small cell lung carcinoma)
- ASB for transcription factors
- CTCF_HUMAN RAD21_HUMAN STAG1_HUMAN MYCN_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | -0.21 | 2.06 | 1.58 | 2.96 | Concordant | |||
| RAD21_HUMAN | 0.37 | 1.89 | 1.55 | n/a | n/a | |||
| STAG1_HUMAN | -2.42 | 1.96 | 1.33 | n/a | n/a | |||
| MYCN_HUMAN | -0.58 | 2.06 | 1.05 | n/a | No Hit | |||
| STAT1_HUMAN | -1.89 | 3.00 | 2.00 | n/a | No Hit |
Items per page:
1 – 5 of 12
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Cerebellum, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Thyroid, Whole_Blood