rs6501725 chr17:68759989 G>A
- Sequence
ctgggctgtcttgaaatctgaggg[G/A]aaaagtctgtgaggcgtggccggc
- ASB in cell types
- HCASMC (Human coronary artery smooth muscle cells) GM12878 (female B-cells lymphoblastoid cell line) GM19099 (female B-cells Lymphoblastoid Cell Lines) GM02255 (Lymphoblastoid Cell Lines)
- ASB for transcription factors
- TCF21_HUMAN CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TCF21_HUMAN | 1.70 | n/a | 2.00 | n/a | n/a | |||
| CTCF_HUMAN | 0.78 | 0.20 | 1.39 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP arthritis including non-rheumatoid, diastolic blood pressure (dbp), hip bone mineral density (bmd), neuroblastoma (brain cancer), spine bone mineral density (bmd), years of education