rs6501726 chr17:74602230 C>A
- Sequence
gttgaagtgaccatttacccaggt[C/A]ggagcagctccctcctgtaccaaa
- ASB in cell types
- MS-1 (Small cell lung carcinoma) neutrophils from periferal blood THP-1 (acute monocytic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MS-1 (Small cell lung carcinoma) | -2.78 | 1.54 | 1.33 | |||
| neutrophils from periferal blood | 2.79 | -5.12 | 2.00 | |||
| THP-1 (acute monocytic leukemia) | 0.82 | 0.38 | 1.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Colon_Transverse, Lung, Nerve_Tibial, Spleen, Testis, Thyroid, Whole_Blood