rs6501728 chr17:74602553 A>G
- Sequence
cagagcaagcctcagtatctctgt[A/G]tgtctctatctgctattatcagag
- ASB in cell types
- spleen
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| spleen | -2.34 | 2.45 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Colon_Transverse, Lung, Nerve_Tibial, Spleen, Testis, Whole_Blood